WormBase Tree Display for Variation: WBVar00249359

WBVar00249359 Name: Public_name: tm311
    Other_name: R03E9.1.1:c.154+23_436-130del
    HGVSg: CHROMOSOME_X:g.6742662_6743129del
  Sequence_details: SMap: S_parent: Sequence: R03E9
    Flanking_sequences: ttcaaatggtaaagacatgacatttcgtaa ttttccaattagtcccactactcccacaac
    Mapping_target: R03E9
    Source_location: 7 CHROMOSOME_X 6742661 6743130 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm311_external
      tm311_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 311
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003163
    Transcript: R03E9.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: R03E9.1.1:c.154+23_436-130del
        Intron_number: 2-3/4
        Exon_number: 3/5
    Interactor: WBInteraction000524630
      WBInteraction000524631
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000031 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. B. Conradt to the National Bioresource Project of Japan: slow growth at 15C (possibly lethal). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: MD
      WBPhenotype:0000039 Paper_evidence: WBPaper00061439
        Curator_confirmed: WBPerson49407
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. B. Conradt: slow growth at 15C (possibly lethal). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
              MD
      WBPhenotype:0000114 Paper_evidence: WBPaper00040863
        Curator_confirmed: WBPerson2987
        Remark: mdl-1(tm311) mutants exhibited wild type levels of ftn-1 mRNA expression, as determined by qRT-PCR (Figure 2B) Paper_evidence: WBPaper00040863
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000520 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. L. Mathies to the National Bioresource Project of Japan: no obvious morphological defects. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: RA
      WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. J. Kaplan: non-Egl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KP
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. L. Mathies to the National Bioresource Project of Japan: locomotion normal. Comment to the NBP from Dr. J. Kaplan: non-Unc. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: RA
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. L. Mathies to the National Bioresource Project of Japan: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: RA
      WBPhenotype:0001510 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. O. Hobert to the National Bioresource Project of Japan: ASE and AIY fate markers normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OH
      WBPhenotype:0001838 Paper_evidence: WBPaper00040863
        Curator_confirmed: WBPerson2987
        Remark: mdl-1(tm311) mutant animals displayed an induction of ftn-1 mRNA expression in response to 25 millimolar iron (ferric ammonium citrate) similar to that of wild type animals (Figure S1A). Paper_evidence: WBPaper00040863
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00003020 Paper_evidence: WBPaper00040863
              Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: Animals were treated with iron (25 millimolar ferric ammonium citrate, FAC) and ftn-1 transcript levels measured by qRT-PCR Paper_evidence: WBPaper00040863
              Curator_confirmed: WBPerson2987
  Reference: WBPaper00040863
    WBPaper00061439
  Remark: 12683/12684-13151/13152 (468 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele