WormBase Tree Display for Variation: WBVar00249361

WBVar00249361 Name: Public_name: tm313
    Other_name: T14G12.4a.1:c.109+293_110-125delinsATAT
    HGVSg: CHROMOSOME_X:g.3741513_3741853delinsATAT
  Sequence_details: SMap: S_parent: Sequence: T14G12
    Flanking_sequences: ccgcaacaacatgacagctggtcgccgcgt atatatttagagctctataattatccgaga
    Mapping_target: T14G12
    Source_location: 7 CHROMOSOME_X 3741512 3741854 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: atat
      Deletion
    PCR_product: tm313_external
      tm313_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 313
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00197554
      WBGene00001434
    Transcript: T14G12.9 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      T14G12.4a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: T14G12.4a.1:c.109+293_110-125delinsATAT
        Intron_number: 2/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000615 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. P. Sengupta to the National Bioresource Project of Japan: normal ciliary structure of AWC, AWB and ADF neurons. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. P. Sengupta to the National Bioresource Project of Japan: not uncoordinated. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 13301/13302-atat-13642/13643 (341 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele