WormBase Tree Display for Variation: WBVar00249806
expand all nodes | collapse all nodes | view schema
WBVar00249806 | Name | Public_name | tm778 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C24G7.4.1:c.555_1051-19del | |||||||
HGVSg | CHROMOSOME_I:g.4095894_4096623del | |||||||
Sequence_details | SMap | S_parent | Sequence | C24G7 | ||||
Flanking_sequences | ggaaacattggaatatcttttacaaacaaa | aactgaaaatattttcagcacaatctccta | ||||||
Mapping_target | C24G7 | |||||||
Source_location | 7 | CHROMOSOME_I | 4095893 | 4096624 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm778_external | |||||||
tm778_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 778 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00016066 | ||||||
Transcript | C24G7.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C24G7.4.1:c.555_1051-19del | |||||||
cDNA_position | 574-? | |||||||
CDS_position | 555-? | |||||||
Protein_position | 185-? | |||||||
Intron_number | 4-6/9 | |||||||
Exon_number | 4-6/10 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000531 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal development. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000535 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal body size/shape. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000673 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. N. Tavernarakis to the National Bioresource Project of Japan: normal brood size. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 30194/30195-30924/30925 (730 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |