WormBase Tree Display for Variation: WBVar00249816
expand all nodes | collapse all nodes | view schema
WBVar00249816 | Name | Public_name | tm788 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_X:g.12466567_12467370delinsAAAGCAATATAAATTTTAAAAGCAATACCTCTCCGATTGCTATCATGTGAATCTGTTGAGTCAGCTTC | |||||||
Sequence_details | SMap | S_parent | Sequence | T18D3 | ||||
Flanking_sequences | atcatgtgaatctgttgagtcagcttcatc | taaattcatatgcatatggctcactctgac | ||||||
Mapping_target | T18D3 | |||||||
Source_location | 7 | CHROMOSOME_X | 12466566 | 12467371 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AAAGCAATATAAATTTTAAAAGCAATACCTCTCCGATTGCTATCATGTGAATCTGTTGAGTCAGCTTC | ||||||
Deletion | ||||||||
PCR_product | tm788_external | |||||||
tm788_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (6) | ||||||||
Affects | Gene | WBGene00011821 | ||||||
Transcript | T18D3.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-245 | |||||||
CDS_position | ?-105 | |||||||
Protein_position | ?-35 | |||||||
Intron_number | 2/9 | |||||||
Exon_number | 1-3/10 | |||||||
Interactor | WBInteraction000524618 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000136 | Paper_evidence | WBPaper00040622 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | An analysis of ttm-1 transcripts using qRT-PCR showed a small increase in ttm-1 transcript levels in cdf-2 mutant animals compared to wild-type animals (data not shown). | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00033166 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The abundance of the cdf-2 transcript was dramatically reduced by approximately 1,000-fold in the cdf-2(tm788) mutant compared to wild type | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Quantitative, real-time PCR analysis | Paper_evidence | WBPaper00033166 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001747 | Paper_evidence | WBPaper00033166 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | cdf-2(tm788) mutant animals displayed reduced population growth compared to wild-type animals in 30 M to 480 M dietary zinc | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003477 | Paper_evidence | WBPaper00033166 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Eggs were transferred to CeMM with 18-19 different concentrations of zinc, ranging from no added zinc to 2 mM zinc | Paper_evidence | WBPaper00033166 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001749 | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | cdf-2(tm788) mutant animals displayed significantly lower growth rates than wild-type animals at all concentrations of supplemental zinc (Figure 6B). | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00005064 | Paper_evidence | WBPaper00040622 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Hermaphrodites were synchronized at the L1 stage and cultured on noble agar minimal medium (NAMM) dishes for 3 days with supplemental zinc. The length of individual animals was measured using microscopy and ImageJ software. | Paper_evidence | WBPaper00040622 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001849 | Paper_evidence | WBPaper00033166 | ||||||
WBPaper00040622 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Remark | cdf-2(tm788) mutant animals displayed reduced zinc content at dietary zinc concentrations of 30 M and higher compared to wild-type animals | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
In contrast to wild-type, bilobed gut granules were not stained asymmetrically with FluoZin-3 in cdf-2(tm788) mutant animals (Figure S7B). These results indicate that CDF-2 activity is necessary for the asymmetric accumulation of zinc. | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
cdf-2(tm788) mutant animals precultured with 50 μM supplemental zinc and then transferred to medium supplemented with 100 μM TPEN (zinc chelator,N,N,N0,N0-tetrakis (2-pyridylmethyl) ethylenediamine) did not display a significant increase in growth rate compared to cdf-2(tm788) mutant animals not precultured with supplemental zinc and then transferred to medium supplemented with 100 μM TPEN (Figures 7C), unlike wild type animals. These results indicate that CDF-2 is necessary for zinc storage, which promotes the resistance to zinc deficiency. | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033166 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00005064 | Paper_evidence | WBPaper00033166 | ||||
WBPaper00040622 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Determination of zinc content of C. elegans using inductively coupled plasma-mass spectrometry (ICP-MS) | Paper_evidence | WBPaper00033166 | ||||
Curator_confirmed | WBPerson712 | |||||||
cdf-2(tm788) L1 stage hermaphrodites were precultured for 12 hours on noble agar minimal medium (NAMM) dishes containing 0 or 50 micromolar supplemental zinc, cultured for 3 days on NGM dishes with 100 micromolar TPEN (zinc chelator,N,N,N0,N0-tetrakis (2-pyridylmethyl) ethylenediamine), and analyzed individually for length. | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002245 | Paper_evidence | WBPaper00040622 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | cdf-2(tm788) mutant animals displayed significantly lower FluoZin-3 fluorescence at both 0 mM and 100 mM supplemental zinc compared to wild-type animals (Figures 3C and 3D), indicative of reduced endogenous zinc levels. cdf-2(tm788) mutants also exhibited reduced zinc content as determined by inductively coupled plasma-mass spectrometry (ICP-MS) (Figure 2B). | Paper_evidence | WBPaper00040622 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed (11) | ||||||||
Reference | WBPaper00040622 | |||||||
WBPaper00033166 | ||||||||
Remark | 28668/28669-AAAGCAATATAAATTTTAAAAGCAATACCTCTCCGATTGCTATCATGTGAATCTGTTGAGTCAGCTTC-29472/29473 (804 bp deletion +69 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |