WormBase Tree Display for Variation: WBVar00249940

WBVar00249940 Name: Public_name: tm918
    HGVSg: CHROMOSOME_II:g.290489_291313del
  Sequence_details: SMap: S_parent: Sequence: B0432
    Flanking_sequences: cagatttgaagtcaaaaaccaagaaattga gcgaatttttcacttgcaacgtggcctgga
    Mapping_target: B0432
    Source_location: 7 CHROMOSOME_II 290488 291314 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm918_external
      tm918_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 918
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015184
    Transcript: B0432.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2-3/4
        Exon_number: 1-3/5
    Interactor: WBInteraction000520999
      WBInteraction000524443
      WBInteraction000524444
      WBInteraction000524465
      WBInteraction000524467
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000136 Paper_evidence: WBPaper00044740
        Curator_confirmed: WBPerson712
        Remark: Gene expression data reveal inherently upregulated skn-1 mRNA levels in the deletion mutants compared to WT. Whereas mRNA levels of dat-1 are reduced in both Mn treated and untreated mutants compared to WT worms. Paper_evidence: WBPaper00044740
            Curator_confirmed: WBPerson712
      WBPhenotype:0000661 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: solitary social feeding. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001171 Paper_evidence: WBPaper00042333
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited decreased viability compared to N2. Paper_evidence: WBPaper00042333
            Curator_confirmed: WBPerson712
      WBPhenotype:0001863 Paper_evidence: WBPaper00044774
        Curator_confirmed: WBPerson712
        Remark: Mn uptake in this mutant is significantly higher compared to WT worms. Paper_evidence: WBPaper00044774
            Curator_confirmed: WBPerson712
      WBPhenotype:0001904 Paper_evidence: WBPaper00044740
        Curator_confirmed: WBPerson712
        Remark: djr1.1 mutants were less sensitive to acute Mn exposure vs. WT worms. Paper_evidence: WBPaper00044740
            Curator_confirmed: WBPerson712
      WBPhenotype:0002230 Paper_evidence: WBPaper00044740
        Curator_confirmed: WBPerson712
        Remark: Deletion mutants exhibited an enhanced Mn accumulation compared to WT worms. Paper_evidence: WBPaper00044740
            Curator_confirmed: WBPerson712
      WBPhenotype:0002231 Paper_evidence: WBPaper00044740
        Curator_confirmed: WBPerson712
        Remark: In response to sub-lethal, acute Mn treatment (respective LD25), WT worms showed a time-dependent increase in Mn-induced RONS (reactive oxygen and nitrogen species) that was exacerbated in this mutant. Paper_evidence: WBPaper00044740
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: normal egg-laying. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan from Dr. C.L. Creasy: normal locomotion; Dr. S. McIntire: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001547 Paper_evidence: WBPaper00042333
        Curator_confirmed: WBPerson712
        Remark: Glyoxylase activity was increased in dauer vs normal extracts as observed for extracts of N2 animals. Paper_evidence: WBPaper00042333
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00004292 Paper_evidence: WBPaper00042333
              Curator_confirmed: WBPerson712
            WBMol:00005341 Paper_evidence: WBPaper00042333
              Curator_confirmed: WBPerson712
  Reference: WBPaper00042333
    WBPaper00044740
    WBPaper00044774
  Remark: 33128/33129-33953/33954 (825 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele