WormBase Tree Display for Variation: WBVar00249946

WBVar00249946 Name: Public_name: tm924
    Other_name: CE01781:p.Lys79_Ter201delinsThrAlaAspMetAsnTyrPheHis
      C14F5.2.1:c.236_601delinsCGGCCGATATGAACTACTTCC
    HGVSg: CHROMOSOME_X:g.7931078_7931498delinsCGGCCGATATGAACTACTTCC
  Sequence_details: SMap: S_parent: Sequence: C14F5
    Flanking_sequences: ccacaccgactggagtcatttactgggaaa acagcggccgatatgaactacttccatccg
    Mapping_target: C14F5
    Source_location: 7 CHROMOSOME_X 7931077 7931499 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CGGCCGATATGAACTACTTCC
      Deletion
    PCR_product: tm924_external
      tm924_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 924
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006980
    Transcript: C14F5.2.1 (11)
    Interactor: WBInteraction000009148
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0001503 Paper_evidence: WBPaper00035166
        Curator_confirmed: WBPerson712
        Remark: Neuroanatomical analysis of ventral nerve cord architecture in these mutants demonstrate a post-developemental axon flip-over phenotype involving PVQ and PVP axons. No defects were seen in the maintenance of other neuron axons or soma. Paper_evidence: WBPaper00035166
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006976 PATO:0000460 Paper_evidence: WBPaper00035166
                Curator_confirmed: WBPerson712
            WBbt:0006832 PATO:0000460 Paper_evidence: WBPaper00035166
                Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Paper_evidence: WBPaper00035166
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Peter: does not suppress par-2 (RNAi). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
              TA
      WBPhenotype:0000072 Paper_evidence: WBPaper00035166
        Curator_confirmed: WBPerson712
        Remark: Animals do not exhibit any gross morphological defects compared to control animals. Paper_evidence: WBPaper00035166
            Curator_confirmed: WBPerson712
      WBPhenotype:0000180 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. O. Hobert to the National Bioresource Project of Japan: no axonal defects in PVQ neurons. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OH
        EQ_annotations: Anatomy_term: WBbt:0006976 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
      WBPhenotype:0000517 Paper_evidence: WBPaper00035166
        Curator_confirmed: WBPerson712
      WBPhenotype:0000672 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. K. Shen to the National Bioresource Project of Japan: HSN presynaptic vesicle localization normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: TV
      WBPhenotype:0000880 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. O. Hobert to the National Bioresource Project of Japan: no axonal defects in PVQ neurons. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OH
        EQ_annotations: Anatomy_term: WBbt:0006976 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
      WBPhenotype:0000905 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. Dr. T. Kubo to the National Bioresource Project of Japan: normal AIM morphology. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: UTK
        EQ_annotations: Anatomy_term: WBbt:0006814 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
  Reference: WBPaper00035166
  Remark: 1484/1485-CGGCCGATATGAACTACTTCC-1905/1906 (421 bp deletion +21 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele