WormBase Tree Display for Variation: WBVar00250109

WBVar00250109 Name: Public_name: tm1092
    Other_name: F07G6.1.1:c.300_315-493del
    HGVSg: CHROMOSOME_X:g.1730157_1730885del
  Sequence_details: SMap: S_parent: Sequence: F07G6
    Flanking_sequences: aatgaatatatcatcgatttctattttgaa acatttaattagtctatcacgcaaaattac
    Mapping_target: F07G6
    Source_location: 7 CHROMOSOME_X 1730156 1730886 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1092_external
      tm1092_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1092
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00017221
    Transcript: F07G6.1.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F07G6.1.1:c.300_315-493del
        cDNA_position: 300-?
        CDS_position: 300-?
        Protein_position: 100-?
        Intron_number: 1/2
        Exon_number: 1/3
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
    Mapping_data: In_multi_point: 5050
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000531 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. McIntire to the National Bioresource Project of Japan: normal development. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. S. McIntire to the National Bioresource Project of Japan: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 27727/27728-28456/28457 (729 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele