WormBase Tree Display for Variation: WBVar00250121
expand all nodes | collapse all nodes | view schema
WBVar00250121 | Name | Public_name | tm1104 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F11A6.1a.1:c.487_956+17del | |||||||
F11A6.1a.2:c.487_956+17del | ||||||||
HGVSg | CHROMOSOME_I:g.11677017_11678257del | |||||||
Sequence_details | SMap | S_parent | Sequence | F11A6 | ||||
Flanking_sequences | atttttgaagaggatgatgatggtactcaa | gaattgagccaaaatttacaatttcatcag | ||||||
Mapping_target | F11A6 | |||||||
Source_location | 7 | CHROMOSOME_I | 11677016 | 11678258 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1104_external | |||||||
tm1104_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1104 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002232 | ||||||
Transcript | F11A6.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F11A6.1a.1:c.487_956+17del | |||||||
cDNA_position | 587-? | |||||||
CDS_position | 487-? | |||||||
Protein_position | 163-? | |||||||
Intron_number | 3-4/8 | |||||||
Exon_number | 3-4/9 | |||||||
F11A6.1a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F11A6.1a.2:c.487_956+17del | |||||||
cDNA_position | 591-? | |||||||
CDS_position | 487-? | |||||||
Protein_position | 163-? | |||||||
Intron_number | 3-4/8 | |||||||
Exon_number | 3-4/9 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Phenotype_not_observed | WBPhenotype:0002535 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. S. Shaham to the National Bioresource Project of Japan: no apparent defects in amphid dendrite structure. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 23187/23188-24428/24429 (1241 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |