WormBase Tree Display for Variation: WBVar00250177

WBVar00250177 Name: Public_name: tm1165
    Other_name: ZK180.1.1:c.1407-19_1751del
    HGVSg: CHROMOSOME_IV:g.4498345_4498708del
  Sequence_details: SMap: S_parent: Sequence: ZK180
    Flanking_sequences: aatatacttacaatgtgaggaagttcagtg tttttgaagaagaagaaatattttgaagat
    Mapping_target: ZK180
    Source_location: 7 CHROMOSOME_IV 4498344 4498709 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1165_external
      tm1165_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00055690
      WBStrain00055694
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1165
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022675
    Transcript: ZK180.1.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: ZK180.1.1:c.1407-19_1751del
        cDNA_position: ?-1890
        CDS_position: ?-1751
        Protein_position: ?-584
        Intron_number: 11/20
        Exon_number: 12/21
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000500 Paper_evidence: WBPaper00032008
        Curator_confirmed: WBPerson712
        Remark: The time course of aldicarb-induced paralysis was accelerated. Paper_evidence: WBPaper00032008
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Sensitivity to aldiarb was determined by analyzing the onset of paralysis after treatment with 1mM aldicarb. Paper_evidence: WBPaper00032008
              Curator_confirmed: WBPerson712
      WBPhenotype:0000661 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: solitary social feeding. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. J. Kaplan: J. Neurosci 28, 7104 (2008). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: normal egg-laying. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. C.L. Creasy to the National Bioresource Project of Japan: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000845 Paper_evidence: WBPaper00032008
        Curator_confirmed: WBPerson712
        Remark: The time course of levamisole-induced paralysis was not different from wild type. Paper_evidence: WBPaper00032008
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00004019 Paper_evidence: WBPaper00032008
              Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Sensitivity was determined by analyzing the onset of paralysis after treatment with 200uM levamisole. Paper_evidence: WBPaper00032008
              Curator_confirmed: WBPerson712
  Reference: WBPaper00032008
  Remark: 9048/9049-9412/9413 (364 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele