WormBase Tree Display for Variation: WBVar00250696
expand all nodes | collapse all nodes | view schema
WBVar00250696 | Name | Public_name | tm1729 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F54A5.3b.1:c.-250_-111+268delinsAT | |||||||
F54A5.3a.1:c.138-67_210+268delinsAT | ||||||||
F54A5.3b.2:c.-266-67_-194+268delinsAT | ||||||||
HGVSg | CHROMOSOME_I:g.972380_972787delinsAT | |||||||
Sequence_details | SMap | S_parent | Sequence | F54A5 | ||||
Flanking_sequences | tgcaccatgtaacctttctctaataacctg | cttcatgcctgcctaccgcctgatttctaa | ||||||
Mapping_target | F54A5 | |||||||
Source_location | 7 | CHROMOSOME_I | 972379 | 972788 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AT | ||||||
Deletion | ||||||||
PCR_product | tm1729_external | |||||||
tm1729_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1729 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018788 | ||||||
Transcript | F54A5.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F54A5.3a.1:c.138-67_210+268delinsAT | |||||||
Intron_number | 3-4/7 | |||||||
Exon_number | 4/8 | |||||||
F54A5.3b.3 | VEP_consequence | splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1/5 | |||||||
Exon_number | 1/6 | |||||||
F54A5.3b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F54A5.3b.2:c.-266-67_-194+268delinsAT | |||||||
Intron_number | 2-3/7 | |||||||
Exon_number | 3/8 | |||||||
F54A5.3b.1 | VEP_consequence | splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F54A5.3b.1:c.-250_-111+268delinsAT | |||||||
cDNA_position | 3725-? | |||||||
Intron_number | 2/6 | |||||||
Exon_number | 2/7 | |||||||
Interactor | WBInteraction000503796 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype (5) | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00032209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Unlike sek-1(km4) animals, tm1729 mutants did not show any arsenite-sensitive phenotypes. | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004596 | Paper_evidence | WBPaper00032209 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Well-fed young adults of each animal were transferred to normal plates containing 5 mM sodium arsenite. The percentage of animals surviving after incubation for 1 day were scored. | Paper_evidence | WBPaper00032209 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00032209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Well-fed young adults were spotted in the center of normal plates and then killed by chloroform at 4 min after spotting. The percentage of worms located outside of the 2 cm circle was recorded. | Paper_evidence | WBPaper00032209 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000664 | Paper_evidence | WBPaper00032209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000699 | Paper_evidence | WBPaper00032209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032209 | |||||||
Remark | 20469/20470-AT-20877/20878 (408 bp deletion + 2 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |