WormBase Tree Display for Variation: WBVar00250696
expand all nodes | collapse all nodes | view schema
WBVar00250696 | Name | Public_name | tm1729 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F54A5.3b.1:c.-250_-111+268delinsAT | |||||||
F54A5.3a.1:c.138-67_210+268delinsAT | ||||||||
F54A5.3b.2:c.-266-67_-194+268delinsAT | ||||||||
HGVSg | CHROMOSOME_I:g.972380_972787delinsAT | |||||||
Sequence_details | SMap | S_parent | Sequence | F54A5 | ||||
Flanking_sequences | tgcaccatgtaacctttctctaataacctg | cttcatgcctgcctaccgcctgatttctaa | ||||||
Mapping_target | F54A5 | |||||||
Source_location | 7 | CHROMOSOME_I | 972379 | 972788 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AT | ||||||
Deletion | ||||||||
PCR_product | tm1729_external | |||||||
tm1729_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1729 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018788 | ||||||
Transcript | F54A5.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F54A5.3a.1:c.138-67_210+268delinsAT | |||||||
Intron_number | 3-4/7 | |||||||
Exon_number | 4/8 | |||||||
F54A5.3b.3 | VEP_consequence | splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 1/5 | |||||||
Exon_number | 1/6 | |||||||
F54A5.3b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F54A5.3b.2:c.-266-67_-194+268delinsAT | |||||||
Intron_number | 2-3/7 | |||||||
Exon_number | 3/8 | |||||||
F54A5.3b.1 | VEP_consequence | splice_donor_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F54A5.3b.1:c.-250_-111+268delinsAT | |||||||
cDNA_position | 3725-? | |||||||
Intron_number | 2/6 | |||||||
Exon_number | 2/7 | |||||||
Interactor | WBInteraction000503796 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000591 | Paper_evidence | WBPaper00032209 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were hypersensitive to copper, and cadmium. Animals grew poorly on plates containing these metal ions and failed to reach the adult stage within 4 days. | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000593 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. K. Matsumoto: sensitive to copper. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001349 | Paper_evidence | WBPaper00032209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Phosphorylated PMK-1 levels were normal. | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00032209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Phosphorylated KGB-1 levels were significantly decreased, whether treated with Cu2+ or not. | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001724 | Paper_evidence | WBPaper00032209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were cultured from embryogenesis on normal plates containing 1 ug/ml tunicamycin. The percentage of worms reaching adulthood 4 days after egg laying was scored. | Paper_evidence | WBPaper00032209 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed (5) | ||||||||
Reference | WBPaper00032209 | |||||||
Remark | 20469/20470-AT-20877/20878 (408 bp deletion + 2 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |