WormBase Tree Display for Variation: WBVar00251585

WBVar00251585 Name: Public_name: tm2743
    HGVSg: CHROMOSOME_I:g.10568974_10569777del
  Sequence_details: SMap: S_parent: Sequence: F25H2
    Flanking_sequences: gattcggtctcttcgactaaatccacaagt ggatcgcttcaagaacctcgccttcttcat
    Mapping_target: F25H2
    Source_location: 7 CHROMOSOME_I 10568973 10569778 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2743_external
      tm2743_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2743
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009122
      WBGene00198190
      WBGene00004408
      WBGene00009123
      WBGene00045138
    Transcript: F25H2.10.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 990-?
        Exon_number: 5/5
      F25H2.14 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      F25H2.12b.2 VEP_consequence: 5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-365
        Exon_number: 1/11
      F25H2.16 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      F25H2.11.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-411
        CDS_position: ?-389
        Protein_position: ?-130
        Intron_number: 2/3
        Exon_number: 1-3/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Subramaniam: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 35066/35067-35870/35871 (804 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele