WormBase Tree Display for Variation: WBVar00251609

WBVar00251609 Name: Public_name: tm2769
    Other_name: CE05267:p.Arg165SerfsTer2
      CE05266:p.Arg143SerfsTer2
      C12D8.1c.1:c.300_475del
      CE39222:p.Arg102SerfsTer2
      C12D8.1b.1:c.489_664del
      C12D8.1a.1:c.423_598del
      C12D8.1b.2:c.489_664del
    HGVSg: CHROMOSOME_V:g.10237539_10237762del
  Sequence_details: SMap: S_parent: Sequence: C12D8
    Flanking_sequences: cattaccatcacctccactgttaagaattt gtgggattgcaatgtcaatagtggtttggg
    Mapping_target: C12D8
    Source_location: 7 CHROMOSOME_V 10237538 10237764 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: G
      Deletion
    PCR_product: tm2769_external
      tm2769_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2769
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007534
    Transcript: C12D8.1b.2 (11)
      C12D8.1a.1 (11)
      C12D8.1c.1 (11)
      C12D8.1b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000048 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: normal hatching. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000072 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: normal body shape. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark (2)
  Method: NBP_knockout_allele