WormBase Tree Display for Variation: WBVar00251610

WBVar00251610 Name: Public_name: tm2772
    Other_name: F47G4.7.3:c.233_914del
      CE18705:p.Tyr78LeufsTer30
      F47G4.7.2:c.233_914del
      F47G4.7.1:c.233_914del
    HGVSg: CHROMOSOME_I:g.14049274_14050051del
  Sequence_details: SMap: S_parent: Sequence: F47G4
    Flanking_sequences: tgggcatccttccccttctccgaaatgtca aagagtcgatggactcgttgtgcttggagt
    Mapping_target: F47G4
    Source_location: 7 CHROMOSOME_I 14049273 14050052 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2772_external
      tm2772_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2772
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004875
    Transcript: F47G4.7.3 (11)
      F47G4.7.2 (11)
      F47G4.7.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000154 Paper_evidence: WBPaper00035239
        Curator_confirmed: WBPerson2757
      WBPhenotype:0000229 Paper_evidence: WBPaper00035239
        Curator_confirmed: WBPerson2757
      WBPhenotype:0002270 Paper_evidence: WBPaper00035239
        Curator_confirmed: WBPerson2757
        EQ_annotations: Molecule_affected: WBMol:00004777 PATO:0001997 Paper_evidence: WBPaper00035239
                Curator_confirmed: WBPerson2757
    Phenotype_not_observed: WBPhenotype:0000048 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National BioResource Project of Japan from Dr. K.F. O'Connell: normal hatching. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000072 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National BioResource Project of Japan from Dr. K.F. O'Connell: normal body shape. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National BioResource Project of Japan from Dr. K.F. O'Connell: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00035239
  Remark: 568/569-1346/1347 (778 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele