WormBase Tree Display for Variation: WBVar00251643

WBVar00251643 Name: Public_name: tm2815
    Other_name: R06C7.8.1:c.1413_1727del
      CE06251:p.Glu472_Ter576delextTer?
    HGVSg: CHROMOSOME_I:g.7253447_7253850del
  Sequence_details: SMap: S_parent: Sequence: R06C7
    Flanking_sequences: tgggttgaatgttgtttacgatgaggcagc aaatcaagccgttcagccctcagtcacaga
    Mapping_target: R06C7
    Source_location: 7 CHROMOSOME_I 7253446 7253851 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2815_external
      tm2815_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2815
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000275
    Transcript: R06C7.8.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype (11)
    Phenotype_not_observed: WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. H. Sawa: non Psa. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: HS
  Reference: WBPaper00033465
  Remark: 21101/21102-21505/21506 (404 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele