WormBase Tree Display for Variation: WBVar00251725
expand all nodes | collapse all nodes | view schema
WBVar00251725 | Name | Public_name | tm2912 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F02E8.3.1:c.268-38_423del | |||||||
HGVSg | CHROMOSOME_X:g.4458921_4459114del | |||||||
Sequence_details | SMap | S_parent | Sequence | F02E8 | ||||
Flanking_sequences | cattgaaaagtttgtttctaacatggtatt | gaatagacagtcaagatggacccgttcaaa | ||||||
Mapping_target | F02E8 | |||||||
Source_location | 7 | CHROMOSOME_X | 4458920 | 4459115 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2912_external | |||||||
tm2912_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2912 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000157 | ||||||
Transcript | F02E8.3.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F02E8.3.1:c.268-38_423del | |||||||
cDNA_position | ?-423 | |||||||
CDS_position | ?-423 | |||||||
Protein_position | ?-141 | |||||||
Intron_number | 2/3 | |||||||
Exon_number | 3/4 | |||||||
Interactor | WBInteraction000525183 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000030 | Paper_evidence | WBPaper00032011 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals grew almost normally at 15C but partially arrested at 20C. Growth of animals harboring synWT, synA53T or synA30P transgenes was severely arrested, while control animals only had milder growth rate defects. | Paper_evidence | WBPaper00032011 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 20 | Paper_evidence | WBPaper00032011 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay (2) | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. O. Blacque: could not assess Dyf phenotype due to lethality. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
OEB | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00032011 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals displayed defects in a temperature-dependent manner. Motor activities of animals harboring synWT, synA53T or synA30P transgenes were severely impaired, while animals not containing any transgene or containing a control transgene were almost normal. | Paper_evidence | WBPaper00032011 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 20 | Paper_evidence | WBPaper00032011 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay (2) | ||||||||
Reference | WBPaper00032011 | |||||||
Remark | 11246/11247-11440/11441 (194 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |