WormBase Tree Display for Variation: WBVar00251834
expand all nodes | collapse all nodes | view schema
WBVar00251834 | Name | Public_name | tm3051 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE24379:p.Lys21_Ter216delextTer? | |||||||
Y48A6B.11c.1:c.60_647del | ||||||||
Y48A6B.11a.1:c.60_647del | ||||||||
CE54304:p.Lys21_Ter216delextTer? | ||||||||
HGVSg | CHROMOSOME_III:g.11063615_11064401del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y48A6B | ||||
Flanking_sequences | tttcaagtcgtggctcgcaaaaaacgacga | gtcgcctttggtgaaaaaaaccacggaaac | ||||||
Mapping_target | Y48A6B | |||||||
Source_location | 7 | CHROMOSOME_III | 11063614 | 11064402 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm3051_external | |||||||
tm3051_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3051 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects (2) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project from Dr E.T. Kipreos: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project from Dr E.T. Kipreos: fertile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 73470/73471-74257/74258 (787 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |