WormBase Tree Display for Variation: WBVar00252258

WBVar00252258 Name: Public_name: tm3620
    Other_name: ZK75.1.1:c.85_235+2del
    HGVSg: CHROMOSOME_II:g.5996480_5996632del
  Sequence_details: SMap: S_parent: Sequence: ZK75
    Flanking_sequences: tgtcgacaaccttccatggacaccagcaaa acgtttaatgctaaaaattttttaaaaaac
    Mapping_target: ZK75
    Source_location: 7 CHROMOSOME_II 5996479 5996633 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3620_external
      tm3620_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3620
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002087
    Transcript: ZK75.1.1 VEP_consequence: splice_donor_variant,coding_sequence_variant
        VEP_impact: HIGH
        HGVSc: ZK75.1.1:c.85_235+2del
        cDNA_position: 115-?
        CDS_position: 85-?
        Protein_position: 29-?
        Intron_number: 2/3
        Exon_number: 2/4
    Interactor (40)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000012 Paper_evidence: WBPaper00042184
        Curator_confirmed: WBPerson2987
        Remark: "We found that neither deletions in 12 insulins nor knockdown of any of the 40 insulins results in dauers (Fig 1A; Supplemental Table S2)." Paper_evidence: WBPaper00042184
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000013 Paper_evidence: WBPaper00042184
        Curator_confirmed: WBPerson2987
        Remark: "After dauer-inducing conditions, all mutants analyzed were capable of forming dauers, indicating that they are not dauer defective (Fig 1B). " Paper_evidence: WBPaper00042184
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000022 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. Q.L. Ch'ng: non-Lon. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000229 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. Q.L. Ch'ng: non-Sma. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
      WBPhenotype:0000583 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. Q.L. Ch'ng: non-Dpy. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. Q.L. Ch'ng: non-Unc. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
      WBPhenotype:0000697 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. Q.L. Ch'ng: non-Pvl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: QL
  Reference: WBPaper00042184
  Remark: 17584/17585-17737/17738 (153 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele