WormBase Tree Display for Variation: WBVar00274920
expand all nodes | collapse all nodes | view schema
| WBVar00274920 | Evidence | Paper_evidence | WBPaper00031651 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ur299 | |||||||
| Other_name | CE06730:p.Gln1197Ter | ||||||||
| C01B7.6.1:c.3589C>T | |||||||||
| HGVSg | CHROMOSOME_V:g.8815523G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C01B7 | |||||
| Flanking_sequences | tcaaacaatggaactgacgtagatgttgga | agattccggagctgtattatcaaattgtcg | |||||||
| Mapping_target | C01B7 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00031651 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | IM | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00004457 | |||||||
| Transcript | C01B7.6.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C01B7.6.1:c.3589C>T | ||||||||
| HGVSp | CE06730:p.Gln1197Ter | ||||||||
| cDNA_position | 3589 | ||||||||
| CDS_position | 3589 | ||||||||
| Protein_position | 1197 | ||||||||
| Exon_number | 6/16 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Interactor | WBInteraction000500934 | ||||||||
| WBInteraction000500935 | |||||||||
| WBInteraction000500937 | |||||||||
| WBInteraction000500938 | |||||||||
| WBInteraction000503563 | |||||||||
| WBInteraction000503565 | |||||||||
| WBInteraction000518368 | |||||||||
| WBInteraction000518369 | |||||||||
| Genetics | Interpolated_map_position | V | 1.62216 | ||||||
| Description | Phenotype | WBPhenotype:0001224 | Paper_evidence | WBPaper00031828 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | The PLM anterior process axon often extends beyond the normal termination point. | Paper_evidence | WBPaper00031828 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000384 | Paper_evidence | WBPaper00031828 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals do not exhibit dorsal or ventral guidance defects. | Paper_evidence | WBPaper00031828 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBbt:0005278 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBbt:0005274 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00031828 | ||||||||
| WBPaper00031651 | |||||||||
| Method | Substitution_allele |
