WormBase Tree Display for Variation: WBVar00275344
expand all nodes | collapse all nodes | view schema
| WBVar00275344 | Evidence | Paper_evidence | WBPaper00031432 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | y284 | |||||
| Other_name | Y39A1B.3.1:c.3817C>T | ||||||
| CE31734:p.Gln1273Ter | |||||||
| HGVSg | CHROMOSOME_III:g.10772978C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y39A1B | |||
| Flanking_sequences | gagctcaactcgagaactgataccattata | agttgctccccgagttcttgtatcatttgt | |||||
| Mapping_target | Y39A1B | ||||||
| Type_of_mutation | Substitution | c | t | Person_evidence | WBPerson421 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | TY | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001087 | |||||
| Transcript | Y39A1B.3.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | Y39A1B.3.1:c.3817C>T | ||||||
| HGVSp | CE31734:p.Gln1273Ter | ||||||
| cDNA_position | 3833 | ||||||
| CDS_position | 3817 | ||||||
| Protein_position | 1273 | ||||||
| Exon_number | 13/18 | ||||||
| Codon_change | Cag/Tag | ||||||
| Amino_acid_change | Q/* | ||||||
| Genetics | Interpolated_map_position | III | 5.36615 | ||||
| Reference | WBPaper00031432 | ||||||
| Remark | The location of y284 was sent by personal communication from B. Meyer and is a correction of data published in Tsai et al. PMID 18198337 | Curator_confirmed | WBPerson2970 | ||||
| Method | Substitution_allele |
