WormBase Tree Display for Variation: WBVar00275573

WBVar00275573 Evidence: Paper_evidence: WBPaper00036056
  Name: Public_name: ju89
    Other_name: CE46730:p.Gly419Arg
      F26E4.8a.1:c.1240G>C
      F26E4.8b.1:c.1255G>C
      CE09692:p.Gly414Arg
    HGVSg: CHROMOSOME_I:g.9786043C>G
  Sequence_details: SMap: S_parent: Sequence: F26E4
    Flanking_sequences: ccaagtcttcacgagcctcggtgaactctc ctcctccattccttctccgacgtaccagtg
    Mapping_target: F26E4
    Type_of_mutation: Substitution: c g Curator_confirmed: WBPerson4055
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005447
    Laboratory: CZ
    Status: Live
  Affects: Gene: WBGene00006528
    Transcript: F26E4.8a.1 (12)
      F26E4.8b.1 (12)
    Interactor: WBInteraction000525371
  Genetics: Interpolated_map_position: I 3.90462
  Description: Phenotype: WBPhenotype:0000180 Paper_evidence: WBPaper00036056
        Curator_confirmed: WBPerson2021
        Remark: The number of axons in the ventral nerve cord was reduced by 8% compared to wild-type worms, and the number of axons in the dorsal nerve cord was reduced by 16% Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000625 Paper_evidence: WBPaper00036056
        Curator_confirmed: WBPerson2021
        Remark: ju89 worms exhibited multiple defects in the SNB-1::GFP pattern along both the ventral and dorsal nerve cords that suggested a failure to properly form or maintain synapses. The number of DD puncta along the dorsal nerve cord was reduced by an average of 42% in young adult ju89 worms and the number of VD puncta in the ventral nerve cord was reduced by 34%. Cholinergic motor neuron synapses are not globally disrupted in the mutants as indicated by SNT-1 Ab Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
        EQ_annotations: Anatomy_term: WBbt:0005270 PATO:0000460 Paper_evidence: WBPaper00036056
                Curator_confirmed: WBPerson2021
            WBbt:0005303 PATO:0000460 Paper_evidence: WBPaper00036056
                Curator_confirmed: WBPerson2021
      WBPhenotype:0000643 Paper_evidence: WBPaper00036056
        Curator_confirmed: WBPerson2021
        Remark: All ju89 adult worms showed uncoordinated (unc) movement Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000672 Paper_evidence: WBPaper00036056
        Curator_confirmed: WBPerson2021
        Remark: Weak diffuse SNB-1 GFP was observed along commissures suggesting mislocalization of synaptic vesicles to these regions Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001224 Paper_evidence: WBPaper00036056
        Curator_confirmed: WBPerson2021
        Remark: DD outgrowth defects were observed in ju89 mutants Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001321 Paper_evidence: WBPaper00036056
        Curator_confirmed: WBPerson2021
        Remark: UNC-10::GFP puncta were frequently smaller than wild-type and irregularly spaced, and diffuse UNC-10::GFP was visible in the commissures of adult ju89 animals. Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001669 Paper_evidence: WBPaper00036056
        Curator_confirmed: WBPerson2021
        Remark: Compared to wildtype synapses, a reduction in the number of synaptic vesicles is apparent in GABAergic and cholinergic synapses of the mutants Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001672 Paper_evidence: WBPaper00036056
        Curator_confirmed: WBPerson2021
        Remark: Abnormal commissure branching Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001685 Paper_evidence: WBPaper00036056
        Curator_confirmed: WBPerson2021
        Remark: Large gaps in UNC-49::GFP expression were evident along both the dorsal and ventral muscles of adult ju89 mutants, indicating that postsynaptic structures were not present in these regions. In some ju89 mutant animals the GFP-tagged receptor appeared diffused throughout the muscle tissue, consistent with the failure of the receptor to completely localize to synapses. Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
      WBPhenotype:0004022 Paper_evidence: WBPaper00036056
        Curator_confirmed: WBPerson2021
        Remark: The amplitude of the wave pattern was greatly reduced when animals move forward Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
        Variation_effect: Neomorph_gain_of_function: Paper_evidence: WBPaper00036056
            Curator_confirmed: WBPerson2021
  Reference: WBPaper00036056
    WBPaper00051394
  Remark: Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues.
    [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand Curator_confirmed: WBPerson4055
  Method: Substitution_allele