WormBase Tree Display for Variation: WBVar00323186
expand all nodes | collapse all nodes | view schema
WBVar00323186 | Evidence | Paper_evidence | WBPaper00038249 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | vs145 | ||||||
Other_name | CE42722:p.Gly831Arg | |||||||
CE47042:p.Gly885Arg | ||||||||
F52B5.1b.1:c.2491G>C | ||||||||
F52B5.1a.1:c.2365G>C | ||||||||
F52B5.1c.1:c.2653G>C | ||||||||
CE27167:p.Gly789Arg | ||||||||
HGVSg | CHROMOSOME_I:g.8298976C>G | |||||||
Sequence_details | SMap | S_parent | Sequence | F52B5 | ||||
Flanking_sequences | cagcgacatagatgggaagtccaaggaatc | aaccattagaattgaaacagaaagaacgag | ||||||
Mapping_target | F52B5 | |||||||
Type_of_mutation | Substitution | c | g | Curator_confirmed | WBPerson4055 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | LX | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00009920 | ||||||
Transcript | F52B5.1c.1 (12) | |||||||
F52B5.1b.1 (12) | ||||||||
F52B5.1a.1 (12) | ||||||||
Interactor | WBInteraction000501227 | |||||||
WBInteraction000501230 | ||||||||
Genetics | Interpolated_map_position | I | 2.70896 | |||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00038249 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit decreased egg production. | Paper_evidence | WBPaper00038249 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00038249 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001905 | Paper_evidence | WBPaper00038249 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | abts-1 mutants lay fewer cumulative eggs than do wild-type animals. | Paper_evidence | WBPaper00038249 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000546 | Paper_evidence | WBPaper00038249 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038249 | |||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | ||||||
Method | Substitution_allele |