WormBase Tree Display for Variation: WBVar00604077

WBVar00604077 Name: Public_name: tm5819
    Other_name: T05C12.2.1:c.697+14_1061delinsG
    HGVSg: CHROMOSOME_II:g.8175561_8176017delinsC
  Sequence_details: SMap: S_parent: Sequence: T05C12
    Flanking_sequences: aacagtgagcagctaaccgttggactcatt atgtgatttttgcctggtgttccttccaaa
    Mapping_target: T05C12
    Source_location: 7 CHROMOSOME_II 8175560 8176018 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: C
      Deletion
    PCR_product: tm5819_external
      tm5819_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5819
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000053
    Transcript: T05C12.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T05C12.2.1:c.697+14_1061delinsG
        cDNA_position: ?-1061
        CDS_position: ?-1061
        Protein_position: ?-354
        Intron_number: 7-8/11
        Exon_number: 8-9/12
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 7406/7407-C-7863/7864 (457 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele