WormBase Tree Display for Variation: WBVar01429653
expand all nodes | collapse all nodes | view schema
| WBVar01429653 | Evidence | Paper_evidence | WBPaper00041328 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n5214 | |||||
| Other_name | F43G9.10.1:c.1277A>T | ||||||
| CE10372:p.Asp426Val | |||||||
| HGVSg | CHROMOSOME_I:g.8638722T>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F43G9 | |||
| Flanking_sequences | gatgcccaaacaccttgatgatctgttgta | cttcttctgtcaagtgcgtatacttggttc | |||||
| Mapping_target | F43G9 | ||||||
| Type_of_mutation | Substitution | t | a | Curator_confirmed | WBPerson4055 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Linked_to | WBVar02147198 | ||||||
| Affects | Gene | WBGene00009671 | |||||
| Transcript | F43G9.10.1 (12) | ||||||
| Genetics | Interpolated_map_position | I | 3.0135 | ||||
| Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00041328 | |||
| Curator_confirmed | WBPerson2495 | ||||||
| Reference | WBPaper00041328 | ||||||
| Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
| Method | Substitution_allele |
