WormBase Tree Display for Variation: WBVar02123242

WBVar02123242 Name: Public_name: WBVar02123242
    Other_name: cewivar00854165
    HGVSg: CHROMOSOME_IV:g.2796003_2806002del
  Sequence_details: SMap: S_parent: Sequence: Y54G2A
    Flanking_sequences: AAATTTCGGGAAATCTAATTTTTAAAAGTT TTTTCAGCTACTGTGCAGACTCAAAGCTTT
    Mapping_target: Y54G2A
    Source_location: 225 CHROMOSOME_IV 2796001 2806000 From_analysis: Million_mutation_project_reanalysis
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Natural_variant
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00022850 From_analysis: Million_mutation_project_reanalysis
      WBStrain00027662 From_analysis: Million_mutation_project_reanalysis
    Laboratory: VC
    Analysis: Million_mutation_project_reanalysis
    Status: Live
  Affects: Gene (12)
    Transcript (18)
  Remark: The boundaries of this variant have been identified only approximately
    This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous
  Method: WGS_Flibotte