WormBase Tree Display for Variation: WBVar02123579
expand all nodes | collapse all nodes | view schema
WBVar02123579 | Name | Public_name | WBVar02123579 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854502 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_III | ||||
Flanking_sequences | TTTTATGTTAAATTTTTTGAAAATAAATAA | TTGTAATTTTTTCCAGAAAGAGGAGAACAT | ||||||
Mapping_target | CHROMOSOME_III | |||||||
Source_location | 225 | CHROMOSOME_III | 1291001 | 1310000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022878 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00022476 | ||||||
WBGene00022478 | ||||||||
WBGene00219772 | ||||||||
WBGene00022479 | ||||||||
WBGene00022328 | ||||||||
WBGene00022329 | ||||||||
WBGene00022477 | ||||||||
Transcript | Y119D3A.6 | |||||||
Y119D3A.2.1 | ||||||||
Y119D3A.3.1 | ||||||||
Y82E9BL.12.1 | ||||||||
Y82E9BL.13.1 | ||||||||
Y119D3A.1.1 | ||||||||
Y119D3A.4.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |