WormBase Tree Display for Variation: WBVar02147440
expand all nodes | collapse all nodes | view schema
| WBVar02147440 | Evidence | Paper_evidence | WBPaper00050496 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | hp701 | |||||
| Other_name | F56A12.1.1:c.893C>T | ||||||
| CE37921:p.Pro298Leu | |||||||
| HGVSg | CHROMOSOME_V:g.14375684C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F56A12 | |||
| Flanking_sequences | gcagcactaatggtggcagtgactttcttc | aataataactccgcaaagctttaacttggc | |||||
| Mapping_target | F56A12 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00050496 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00052173 | ||||||
| Laboratory | ZM | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006775 | |||||
| Transcript | F56A12.1.1 (12) | ||||||
| Genetics | Interpolated_map_position | V | 6.28307 | ||||
| Reference | WBPaper00050496 | ||||||
| Remark | Incorrectly curated as a C->A change giving rise to a P298Q and not the P298L as stated in the paper. | ||||||
| Method | Substitution_allele |
