WormBase Tree Display for Variation: WBVar02153758
expand all nodes | collapse all nodes | view schema
WBVar02153758 | Name (3) | ||||
---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | Y54G2A | |
Flanking_sequences | AATTCTCCATTATCCGGATTCTCGTGGCGT | TGGAACGGTTGGAATCTGATTTGCAGGTAA | |||
Mapping_target | CHROMOSOME_IV | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Pending_curation | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00047686 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00021868 | |||
Transcript | Y54G2A.2c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | ?-448 | ||||
CDS_position | ?-448 | ||||
Protein_position | ?-150 | ||||
Intron_number | 1-2/4 | ||||
Exon_number | 1-3/5 | ||||
Y54G2A.2a.1 (11) | |||||
Y54G2A.2b.1 (11) | |||||
Isolation | Mutagen | CRISPR_Cas9 | |||
Genetics | Interpolated_map_position | IV | -6.7398 | ||
Remark | Batch created from Strain genotype data | Curator_confirmed | WBPerson1983 | ||
Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is imperfect, but it was not sequenced. | |||||
Method | Deletion_allele |