WormBase Tree Display for Variation: WBVar00143062
expand all nodes | collapse all nodes | view schema
WBVar00143062 | Evidence | Paper_evidence | WBPaper00002990 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e246 | ||||||
Other_name | CE28035:p.Ala248Val | |||||||
F56A8.7b.1:c.743C>T | ||||||||
CE16127:p.Ala248Val | ||||||||
F56A8.7a.1:c.743C>T | ||||||||
F56A8.7a.2:c.743C>T | ||||||||
HGVSg | CHROMOSOME_III:g.13280608C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F56A8 | ||||
Flanking_sequences | tggagcacgcgaaagaatttgttgatcgag | agtagctgatacgaagaaagccgttcaata | ||||||
Mapping_target | F56A8 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002990 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (10) | ||||||||
Laboratory (2) | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006798 | ||||||
Transcript | F56A8.7b.1 (12) | |||||||
F56A8.7a.2 (12) | ||||||||
F56A8.7a.1 (12) | ||||||||
Interactor | WBInteraction000500603 | |||||||
WBInteraction000503382 | ||||||||
WBInteraction000517393 | ||||||||
WBInteraction000518496 | ||||||||
Genetics | Interpolated_map_position | III | 21.1995 | |||||
Mapping_data | In_2_point (9) | |||||||
In_multi_point | 256 | |||||||
375 | ||||||||
1659 | ||||||||
1716 | ||||||||
1756 | ||||||||
1865 | ||||||||
3247 | ||||||||
3262 | ||||||||
3265 | ||||||||
3266 | ||||||||
In_pos_neg_data | 356 | |||||||
1601 | ||||||||
8143 | ||||||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00006029 | ||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Aldicarb resistance was most apparent at 15C but was almost completely rescued at 25C. | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ric | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Cold_sensitive | 15 | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were monitored for paralysis over time in the presence of 1mM alicarb. | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 15, 25 | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000507 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | elevated acetylcholine levels | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | sluggish | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001206 | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit severe movement defects preventing any observation of a plate tap response. | Paper_evidence | WBPaper00038487 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001592 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | will move either forward or backward if prodded but almost immediately jams up | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000032 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | healthy | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on expression analysis of SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001616 | Paper_evidence | WBPaper00024698 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Trimethadione significantly extended life-span of mutant animals (N=245)(2 ind.exp.) as observed for WT. | Paper_evidence | WBPaper00024698 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Lifespan analysis was performed on animals exposed to 4 mg/ml of the drug from fertilization until death. Animals were cultured on NGM plates containing the drug and seeded with OP50. | Paper_evidence | WBPaper00024698 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 20C | Paper_evidence | WBPaper00024698 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001617 | Paper_evidence | WBPaper00024698 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Ethosuximide extended life-span of mutant animals (N=160)(3 ind.exp.), although to a less extent than observed for WT. | Paper_evidence | WBPaper00024698 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Lifespan analysis was performed on animals exposed to 2 mg/ml of the drug from fertilization until death. Animals were cultured on NGM plates containing the drug and seeded with OP50. | Paper_evidence | WBPaper00024698 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 20C | Paper_evidence | WBPaper00024698 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference (25) | ||||||||
Method | Substitution_allele |