WormBase Tree Display for Variation: WBVar00250280
expand all nodes | collapse all nodes | view schema
WBVar00250280 | Name | Public_name | tm1274 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F54A5.1.1:c.461-35_903del | |||||||
HGVSg | CHROMOSOME_I:g.990486_990963del | |||||||
Sequence_details | SMap | S_parent | Sequence | F54A5 | ||||
Flanking_sequences | gaggcgtctgaattcctaggcgaagttgct | gcttcgtcttctgcgtcatcgactgctaat | ||||||
Mapping_target | F54A5 | |||||||
Source_location | 7 | CHROMOSOME_I | 990485 | 990964 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1274_external | |||||||
tm1274_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1274 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018786 | ||||||
Transcript | F54A5.1.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F54A5.1.1:c.461-35_903del | |||||||
cDNA_position | ?-915 | |||||||
CDS_position | ?-903 | |||||||
Protein_position | ?-301 | |||||||
Intron_number | 2/4 | |||||||
Exon_number | 3/5 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000306 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Barr to the National Bioresource Project of Japan: wild-type pkd-2::gfp expression. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |