WormBase Tree Display for Variation: WBVar00250781
expand all nodes | collapse all nodes | view schema
WBVar00250781 | Name | Public_name | tm1817 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | D2030.9b.1:c.677+25_889-128del | |||||||
D2030.9a.2:c.800+25_1012-128del | ||||||||
D2030.9c.1:c.800+25_1012-128del | ||||||||
D2030.9e.1:c.581+25_793-128del | ||||||||
D2030.9d.1:c.581+25_793-128del | ||||||||
D2030.9a.1:c.800+25_1012-128del | ||||||||
HGVSg | CHROMOSOME_I:g.7599392_7600026del | |||||||
Sequence_details | SMap | S_parent | Sequence | D2030 | ||||
Flanking_sequences | aagagagtgagtacatttcacagcaaaaaa | atttattcaaagtttctcaacatgacattg | ||||||
Mapping_target | D2030 | |||||||
Source_location | 7 | CHROMOSOME_I | 7599391 | 7600027 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1817_external | |||||||
tm1817_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00055405 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1817 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00008419 | ||||||
Transcript | D2030.9c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | D2030.9c.1:c.800+25_1012-128del | |||||||
Intron_number | 6-7/11 | |||||||
Exon_number | 7/12 | |||||||
D2030.9d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | D2030.9d.1:c.581+25_793-128del | |||||||
Intron_number | 3-4/7 | |||||||
Exon_number | 4/8 | |||||||
D2030.9a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | D2030.9a.1:c.800+25_1012-128del | |||||||
Intron_number | 6-7/11 | |||||||
Exon_number | 7/12 | |||||||
D2030.9e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | D2030.9e.1:c.581+25_793-128del | |||||||
Intron_number | 3-4/7 | |||||||
Exon_number | 4/8 | |||||||
D2030.9b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | D2030.9b.1:c.677+25_889-128del | |||||||
Intron_number | 5-6/10 | |||||||
Exon_number | 6/11 | |||||||
D2030.9a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | D2030.9a.2:c.800+25_1012-128del | |||||||
Intron_number | 6-7/11 | |||||||
Exon_number | 7/12 | |||||||
Interactor | WBInteraction000051412 | |||||||
WBInteraction000503935 | ||||||||
WBInteraction000520023 | ||||||||
WBInteraction000520024 | ||||||||
WBInteraction000520025 | ||||||||
WBInteraction000520026 | ||||||||
WBInteraction000520027 | ||||||||
WBInteraction000520028 | ||||||||
WBInteraction000521021 | ||||||||
WBInteraction000521022 | ||||||||
WBInteraction000524193 | ||||||||
WBInteraction000525382 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00042215 | ||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson590 | ||||||||
WBPerson557 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. J. Kaplan: resistant to aldicarb | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
wdr-23 mutants were highly resistant to the paralytic effects of aldicarb. | Paper_evidence | WBPaper00042215 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Affected_by | Molecule | WBMol:00003650 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000031 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. K. Strange: Gro | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000050 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. K. Strange: Emb | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00046904 | ||||||
Curator_confirmed | WBPerson6532 | |||||||
WBPhenotype:0000142 | Paper_evidence | WBPaper00032980 | ||||||
Curator_confirmed | WBPerson6532 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00032980 | |||||
Curator_confirmed | WBPerson6532 | |||||||
Recessive | Paper_evidence | WBPaper00032980 | ||||||
Curator_confirmed | WBPerson6532 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032980 | |||||
Curator_confirmed | WBPerson6532 | |||||||
WBPhenotype:0000154 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. K. Strange: small brood size | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00042215 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | wdr-23 mutants were hypersensitive to the paralytic effects of the muscle agonist levamisole. | Paper_evidence | WBPaper00042215 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. J. Kaplan: Unc. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001206 | Paper_evidence | WBPaper00042215 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | wdr-23 mutants had reduced locomotion rates and spent significantly less time moving compared to wild type animals. | Paper_evidence | WBPaper00042215 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001213 | Paper_evidence | WBPaper00042215 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | wdr-23 mutants had reduced locomotion rates and spent significantly less time moving compared to wild type animals. | Paper_evidence | WBPaper00042215 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00032980 | ||||||
Curator_confirmed | WBPerson6532 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00032980 | |||||
Curator_confirmed | WBPerson6532 | |||||||
Recessive | Paper_evidence | WBPaper00032980 | ||||||
Curator_confirmed | WBPerson6532 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032980 | |||||
Curator_confirmed | WBPerson6532 | |||||||
WBPhenotype:0001620 | Paper_evidence | WBPaper00046904 | ||||||
Curator_confirmed | WBPerson6532 | |||||||
WBPhenotype:0001663 | Paper_evidence | WBPaper00053621 | ||||||
Curator_confirmed | WBPerson28450 | |||||||
Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. C.P. Hunter: no growth defects at 20C | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000145 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. C.P. Hunter: no fertility defects at 20C | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Reference | WBPaper00042215 | |||||||
WBPaper00032980 | ||||||||
WBPaper00046904 | ||||||||
WBPaper00053621 | ||||||||
Remark | 34358/34359-34993/34994 (635 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |