WormBase Tree Display for Variation: WBVar00251401

WBVar00251401 Name: Public_name: tm2530
    Other_name: Y51H1A.4.1:c.729+461_1022del
    HGVSg: CHROMOSOME_II:g.13878755_13879719del
  Sequence_details: SMap: S_parent: Sequence: Y51H1A
    Flanking_sequences: ccaaaccgccatgattttctggaaaatcag agttcaggagatgtttaaggagactctaca
    Mapping_target: Y51H1A
    Source_location: 7 CHROMOSOME_II 13878754 13879720 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2530_external
      tm2530_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2530
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00013095
    Transcript: Y51H1A.4.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y51H1A.4.1:c.729+461_1022del
        cDNA_position: ?-1050
        CDS_position: ?-1022
        Protein_position: ?-341
        Intron_number: 5/7
        Exon_number: 6/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000002 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit a weak kinker Unc phenotype. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Penetrance: Complete: Paper_evidence: WBPaper00032356
              Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
      WBPhenotype:0000436 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: ING-3 was absent and thus not observed to colocalize with chromatin in the newly fertilized embryo. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
      WBPhenotype:0000711 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: IR induced embryonic death was increased compared to wild-type animals, based on the number of unhatched embryos among the brood laid 8-12 hours following exposure of adults to 120 Gy of IR. Embryonic death was more severe than in ttTi5439 animals. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were assayed over IR doses of 0-240 Gy. Paper_evidence: WBPaper00032356
              Curator_confirmed: WBPerson712
      WBPhenotype:0001410 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: Endogenous ING-3 was absent in animals as assayed by loss of a single 45 kDa band on western blots recognized by mouse polyclonal anti-ING-3. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
      WBPhenotype:0002541 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited decreased levels of IR-induced germ cell apoptosis. The number of germ cell corpses was half that of wild type following radiation. Allele strength: tm2530>ttTi5439. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005784 PATO:0000460 Paper_evidence: WBPaper00032356
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Cell corpses per gonad arm were assayed for at 0, 12, 24, and 36 hours post IR (Gy) treatment of L4 stage larvae or 24 hours after exposure to 120 Gy of IR. Paper_evidence: WBPaper00032356
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000673 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: Brood size was similar to wild type. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
      WBPhenotype:0000730 Paper_evidence: WBPaper00032356
        Curator_confirmed: WBPerson712
        Remark: Animals displayed normal baseline germ cell death. Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032356
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005175 PATO:0000460 Paper_evidence: WBPaper00032356
                Curator_confirmed: WBPerson712
  Disease_info: Models_disease: DOID:162
    Models_disease_in_annotation: WBDOannot00000525
  Reference: WBPaper00032356
  Remark: 21827/21828-22792/22793 (965 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele