WormBase Tree Display for Variation: WBVar00000263
expand all nodes | collapse all nodes | view schema
WBVar00000263 | Evidence | Paper_evidence | WBPaper00004883 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ar506 | ||||||
Other_name | F25D7.1.1:c.126G>A | |||||||
CE09629:p.Trp42Ter | ||||||||
HGVSg | CHROMOSOME_I:g.10400052C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F25D7 | ||||
Flanking_sequences | tcatcaatgtacaatggatgtttctacaatg | gatctcgtagtcaacaagttccaggtacact | ||||||
Mapping_target | F25D7 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00033458 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00008047 | |||||||
Laboratory | GS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000843 | ||||||
Transcript | F25D7.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F25D7.1.1:c.126G>A | |||||||
HGVSp | CE09629:p.Trp42Ter | |||||||
cDNA_position | 126 | |||||||
CDS_position | 126 | |||||||
Protein_position | 42 | |||||||
Exon_number | 1/4 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000051453 | |||||||
WBInteraction000503998 | ||||||||
Genetics | Interpolated_map_position | I | 4.9713 | |||||
Description | Phenotype | WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited an accumulation of GFP in the pseudocoelom, rather than being taken up and degraded by coelomocytes as occurred in control animals. | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | dpy-20(e1282); arIs37[pmyo-3::ssGFP] | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001806 | Paper_evidence | WBPaper00041076 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We found that both R151.6(RNAi) and cup-2(ar506) loss-of-function mutants increased total and apical membrane protein levels of PGP-3(ΔF508)." | Paper_evidence | WBPaper00041076 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | drSi5 [Cbr-unc-119(+); vha-6p::3XFLAG-pgp-3(CFTR deletion F508)-mCherry::unc-54] | Paper_evidence | WBPaper00041076 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals had normal movement. | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | dpy-20(e1282); arIs37[pmyo-3::ssGFP] | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00041076 | |||||||
WBPaper00004883 | ||||||||
Method | Substitution_allele |