WormBase Tree Display for Variation: WBVar00088835
expand all nodes | collapse all nodes | view schema
WBVar00088835 | Evidence | Paper_evidence | WBPaper00003101 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | md1259 | ||||||
Other_name | F56A8.7b.1:c.214+1G>A | |||||||
F56A8.7a.2:c.214+1G>A | ||||||||
F56A8.7a.1:c.214+1G>A | ||||||||
HGVSg | CHROMOSOME_III:g.13278667G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F56A8 | ||||
Flanking_sequences | caattttatcaaatccagttaacgatcaga | tatgttttaaaaaactgaacttttagaaaa | ||||||
Mapping_target | F56A8 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003101 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (3) | ||||||||
Affects | Gene | WBGene00006798 | ||||||
Transcript | F56A8.7b.1 | VEP_consequence | splice_donor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F56A8.7b.1:c.214+1G>A | |||||||
Intron_number | 4/9 | |||||||
F56A8.7a.2 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F56A8.7a.2:c.214+1G>A | |||||||
Intron_number | 4/9 | |||||||
F56A8.7a.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F56A8.7a.1:c.214+1G>A | |||||||
Intron_number | 4/9 | |||||||
Genetics | Interpolated_map_position | III | 21.1946 | |||||
Description | Phenotype | WBPhenotype:0000641 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dispersal index in the absence of anesthetic ~0.38 was significantly reduced compared to N2 ~0.90. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Dispersal assay as reported in Crowder et al.1996; van Swinderen et al. 1997. | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001482 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ~10.2 body bends/minute compared with N2, ~18.6 BBM. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001609 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | EC50 ~0.18 compared with N2 EC50 ~0.75 vol%. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004563 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001611 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | EC50 ~0.17 compared with N2 EC50 ~0.42 vol%. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00001705 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000680 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Measured by the fraction of animals moving after incubation on 0.1mM or 0.5mM aldicarb agar pads. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00004721 | |||||||
Method | Substitution_allele |