WormBase Tree Display for Variation: WBVar00091489

WBVar00091489 Evidence: Person_evidence: WBPerson7734
  Name: Public_name: ok171
    Other_name (14)
    HGVSg: CHROMOSOME_X:g.10609441_10611936del
  Sequence_details: SMap: S_parent: Sequence: M79
    Flanking_sequences: ggatgcattttaacatacgtactcgagttc cggaatttgacttcttgtgtgatgaacatc
    Mapping_target: M79
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00040670
      WBStrain00040671
      WBStrain00040673
    Laboratory: RB
      FB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00000018
    Transcript: M79.1f.1 (11)
      M79.1c.1 (11)
      M79.1e.1 (11)
      M79.1d.1 (11)
      M79.1g.1 (11)
      M79.1a.1 (11)
      M79.1b.1 (11)
  Genetics: Mapping_data: In_multi_point: 4134
  Description: Phenotype: WBPhenotype:0000386 Paper_evidence: WBPaper00033433
        Curator_confirmed: WBPerson2987
        Remark: Copper-induced germ cell apoptosis was slightly increased in abl-1(ok171) mutants (Figure 3B). Paper_evidence: WBPaper00033433
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00002862 Paper_evidence: WBPaper00033433
              Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: Worms were exposed to 10 micromolar of copper for 12 hours Paper_evidence: WBPaper00033433
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000436 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: Animals showed an increase in intensity of nuclear CED-4 staining, indicative of nuclear CED-4 redistribution, after irradiation. Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005175 PATO:0000460 Paper_evidence: WBPaper00032243
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: After animals were exposed to 120 Gy, germ cells were released from gonads and stained with antibodies against C. elegans CED-4 and Ce-lamin. Paper_evidence: WBPaper00032243
              Curator_confirmed: WBPerson712
      WBPhenotype:0000730 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: Animals displayed increased baseline germ cell death. Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005175 PATO:0000460 Paper_evidence: WBPaper00032243
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Germ cell corpses were counted after 120Gy. Data (meanSEM) are collated from 10-15 worms/group. Paper_evidence: WBPaper00032243
              Curator_confirmed: WBPerson712
      WBPhenotype:0001391 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: Animals showed an increase in radiation-induced germ cell apoptosis. Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005784 PATO:0000460 Paper_evidence: WBPaper00032243
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Germ cell corpses were counted after 120Gy. Data (meanSEM) are collated from 10-15 worms/group. Paper_evidence: WBPaper00032243
              Curator_confirmed: WBPerson712
      WBPhenotype:0001742 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: Animals showed prominent mitochondrial perinuclear distribution of ceramide upon irradiation. Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005175 PATO:0000460 Paper_evidence: WBPaper00032243
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Gonads from unirradiated or irradiated worms were dissected, opened by freeze-cracking, and then stained with MID15B4, a specific anti-ceramide antibody. Mitochondria were localized with an antibody to the mitochondrial marker protein OxPhos Complex IV subunit I (COX-IV) or by Rhodamine B staining. Paper_evidence: WBPaper00032243
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0001851 Paper_evidence: WBPaper00027700
        Curator_confirmed: WBPerson2021
        Remark: Mutants did not display significant radiosensitivity when compared with WT N2 C. elegans Paper_evidence: WBPaper00027700
            Curator_confirmed: WBPerson2021
        EQ_annotations: Anatomy_term: WBbt:0006748 PATO:0000460 Paper_evidence: WBPaper00027700
                Curator_confirmed: WBPerson2021
          Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00027700
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: 100-400 Gy radiation Paper_evidence: WBPaper00027700
              Curator_confirmed: WBPerson2021
  Reference: WBPaper00024301
    WBPaper00027700
    WBPaper00017950
    WBPaper00032243
    WBPaper00033433
    WBPaper00010154
  Remark: Last updated on 29 Nov 2002
    Generated by the C. elegans Gene Knockout Consortium
    Knockout originally requested for M79.1 before it was renamed to M79.1a
    Allele sequenced by Elizabeth Marsh Curator_confirmed: WBPerson2970
  Method: KO_consortium_allele