WormBase Tree Display for Variation: WBVar00142936
expand all nodes | collapse all nodes | view schema
WBVar00142936 | Evidence | Paper_evidence | WBPaper00005582 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e53 | |||||||
Other_name | B0273.4f.1:c.62G>A | ||||||||
B0273.4d.1:c.524G>A | |||||||||
B0273.4b.1:c.848G>A | |||||||||
CE37693:p.Trp283Ter | |||||||||
CE49300:p.Trp21Ter | |||||||||
CE49241:p.Trp175Ter | |||||||||
B0273.4c.1:c.932G>A | |||||||||
B0273.4e.1:c.347G>A | |||||||||
B0273.4d.2:c.524G>A | |||||||||
B0273.4a.1:c.848G>A | |||||||||
CE16791:p.Trp311Ter | |||||||||
CE49455:p.Trp116Ter | |||||||||
CE16790:p.Trp283Ter | |||||||||
HGVSg | CHROMOSOME_IV:g.5499260C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0273 | |||||
Flanking_sequences | ttgatggaggatggagttcatggagtgatt | gagtgcttgctcttcgagttgtcatcggta | |||||||
Mapping_target | B0273 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (49) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006745 | |||||||
Transcript | B0273.4f.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4f.1:c.62G>A | ||||||||
HGVSp | CE49300:p.Trp21Ter | ||||||||
cDNA_position | 62 | ||||||||
CDS_position | 62 | ||||||||
Protein_position | 21 | ||||||||
Exon_number | 1/4 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0273.4e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4e.1:c.347G>A | ||||||||
HGVSp | CE49455:p.Trp116Ter | ||||||||
cDNA_position | 347 | ||||||||
CDS_position | 347 | ||||||||
Protein_position | 116 | ||||||||
Exon_number | 2/5 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0273.4c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4c.1:c.932G>A | ||||||||
HGVSp | CE16791:p.Trp311Ter | ||||||||
cDNA_position | 932 | ||||||||
CDS_position | 932 | ||||||||
Protein_position | 311 | ||||||||
Exon_number | 6/10 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0273.4a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4a.1:c.848G>A | ||||||||
HGVSp | CE16790:p.Trp283Ter | ||||||||
cDNA_position | 850 | ||||||||
CDS_position | 848 | ||||||||
Protein_position | 283 | ||||||||
Exon_number | 6/10 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0273.4d.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4d.2:c.524G>A | ||||||||
HGVSp | CE49241:p.Trp175Ter | ||||||||
cDNA_position | 528 | ||||||||
CDS_position | 524 | ||||||||
Protein_position | 175 | ||||||||
Exon_number | 4/8 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0273.4b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4b.1:c.848G>A | ||||||||
HGVSp | CE37693:p.Trp283Ter | ||||||||
cDNA_position | 848 | ||||||||
CDS_position | 848 | ||||||||
Protein_position | 283 | ||||||||
Exon_number | 5/6 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0273.4d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4d.1:c.524G>A | ||||||||
HGVSp | CE49241:p.Trp175Ter | ||||||||
cDNA_position | 727 | ||||||||
CDS_position | 524 | ||||||||
Protein_position | 175 | ||||||||
Exon_number | 5/9 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor (26) | |||||||||
Genetics | Interpolated_map_position | IV | 1.757 | ||||||
Mapping_data | In_2_point (10) | ||||||||
In_multi_point (47) | |||||||||
In_pos_neg_data | 3700 | ||||||||
Description | Phenotype (20) | ||||||||
Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | grows well | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00036484 | |||||||
WBPaper00040147 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The primary axon of ADL grows into the nerve ring ventrally rather than laterally. This phenotype occurs at a lower frequency than the axon branching phenotype. AVM axons fail to grow ventrally. HSN motor neurons fail to polarize properly. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals do not exhibit any defects in ventrally-directed HSN axon guidance. | Paper_evidence | WBPaper00040147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00040147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that unc-5 mutants also had almost normal Q cell migrations (Fig. 2); thus UNC-5 does not appear to be a part of the UNC-40-dependent Q guidance system." | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00036484 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ADL projects normal dorsal and ventral branches. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ventral muscle arm extension in animals was indistinguishable from that of wild-type controls. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (38) | |||||||||
Method | Substitution_allele |