WormBase Tree Display for Variation: WBVar00146522

WBVar00146522 Evidence: Paper_evidence: WBPaper00003548
  Name: Public_name: h289
    Other_name: B0207.4.2:c.630G>A
      CE24761:p.Trp210Ter
      B0207.4.1:c.630G>A
    HGVSg: CHROMOSOME_I:g.5938301G>A
  Sequence_details: SMap: S_parent: Sequence: B0207
    Flanking_sequences: TGGTGAATGGAGCCGATCACAGTGACGCAGTTGACTTATG GCAATCGGCGTTCTCTGCTATGAGTTTCTCGTTGGAAAAC
    Mapping_target: CHROMOSOME_I
    Source_location: 200 CHROMOSOME_I 5938303 5938303
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00023752
    Laboratory: KR
    Analysis: WGS_Rose
    Status: Live
  Affects: Gene: WBGene00000099
    Transcript: B0207.4.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: B0207.4.1:c.630G>A
        HGVSp: CE24761:p.Trp210Ter
        cDNA_position: 637
        CDS_position: 630
        Protein_position: 210
        Exon_number: 5/7
        Codon_change: tgG/tgA
        Amino_acid_change: W/*
      B0207.4.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: B0207.4.2:c.630G>A
        HGVSp: CE24761:p.Trp210Ter
        cDNA_position: 711
        CDS_position: 630
        Protein_position: 210
        Exon_number: 6/8
        Codon_change: tgG/tgA
        Amino_acid_change: W/*
  Genetics: Interpolated_map_position: I 0.482348
    Mapping_data: In_2_point: 5225
        5226
      In_pos_neg_data (12)
  Description: Phenotype: WBPhenotype:0000062 Paper_evidence: WBPaper00040589
        Curator_confirmed: WBPerson712
      WBPhenotype:0000447 Paper_evidence: WBPaper00002829
        Curator_confirmed: WBPerson712
        Remark: mutants arrested as adult hermaphrodites Paper_evidence: WBPaper00002829
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00002829
          Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00002829
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: dpy-5 unc-13; sDp2 Paper_evidence: WBPaper00002829
              Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Paper_evidence: WBPaper00003985
          WBPaper00002829
        Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: sterile adult Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
          sterile adult mutants had a normal life-span of two to three weeks and grew to the expected size for Unc-13 adults (0.6+/-0.8 mm) Paper_evidence: WBPaper00002829
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00002829
          Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00002829
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: dpy-5 unc-13; sDp2 Paper_evidence: WBPaper00002829
              Curator_confirmed: WBPerson712
      WBPhenotype:0000691 Paper_evidence: WBPaper00002829
        Curator_confirmed: WBPerson712
        Remark: mutants failed to develop a normal gonad; DAPI staining revealed a group of nuclei clustered at the vulva but no structure that could be recognized as a gonad was observed; Homozygotes for let-603(h289) lacked gonads. Where the gonads should have been located, there was a mass of undifferentiated, tumor-like tissue. The tissue mass caused these animals to bulge in the center, since the diameter of the animal here was larger than it was anteriorly or posteriorly. DAPI staining revealed a group of nuclei, which might be undifferentiated germ cells. The tissue mass subsequently became necrotic, degenerating into a localized group of nuclei. Paper_evidence: WBPaper00002829
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00002829
          Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00002829
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: dpy-5 unc-13; sDp2 Paper_evidence: WBPaper00002829
              Curator_confirmed: WBPerson712
      WBPhenotype:0000698 Paper_evidence: WBPaper00002829
        Curator_confirmed: WBPerson712
        Remark: Homozygotes for let-603(h289) lacked a vulva Paper_evidence: WBPaper00002829
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00002829
          Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00002829
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: dpy-5 unc-13; sDp2 Paper_evidence: WBPaper00002829
              Curator_confirmed: WBPerson712
      WBPhenotype:0001038 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: gonad tumorous mass Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000670 Paper_evidence: WBPaper00002829
        Curator_confirmed: WBPerson712
        Remark: none of the sterile mutants were rescued by wild-type sperm, thereforenone of them had defects in spermatogenesis alone. Paper_evidence: WBPaper00002829
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00002829
          Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00002829
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: dpy-5 unc-13; sDp2 Paper_evidence: WBPaper00002829
              Curator_confirmed: WBPerson712
  Reference: WBPaper00040589
    WBPaper00003548
    WBPaper00002829
    WBPaper00000975
    WBPaper00003985
    WBPaper00000699
    WBPaper00045317
  Method: Substitution_allele