WormBase Tree Display for Variation: WBVar00248936
expand all nodes | collapse all nodes | view schema
WBVar00248936 | Evidence | Paper_evidence | WBPaper00004721 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy192 | |||||||
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_I:g.7525779C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C26C6 | |||||
Flanking_sequences | attgccacatgacatgtgccacagacacaa | taacattcaatttgtgtttgacgctgtcac | |||||||
Mapping_target | C26C6 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030824 | ||||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001648 | |||||||
Transcript | C26C6.2.1 (12) | ||||||||
Genetics | Interpolated_map_position | I | 2.10036 | ||||||
Mapping_data | In_multi_point | 3230 | |||||||
3231 | |||||||||
Description | Phenotype | WBPhenotype:0000004 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000546 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 92% eggs laid by sy192/+ are early. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | 96% eggs laid are early (e.g. 8 or fewer cells.) (n=56) | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Dominant_negative_gain_of_function | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000642 | Paper_evidence | WBPaper00004721 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygous animals are hyperactive as assayed by large increase in the number of body bends/min, ~40.1 (n=27) vs. N2 ~24.9 (n=26). Heterozygotes also display a significant increase in body bends, ~44.4 (n=27). | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Dominant_negative_gain_of_function | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000680 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were not blocked in halothane induced aldicarb resistance, even at very high concentrations of the volatile anesthetic unlike in WT animals. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001705 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00003650 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000845 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Data not shown. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001414 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001506 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an significant increase in spontaneous reversals (~5 backward movements initiated/minute over 2 minutes) (n=27). sy192/+ animals do not exhibit a significant increase in reversals. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001618 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an EC50 of ~1.07 for halothane, whereas N2 has an EC50 of ~0.42 vol%,as determined by a concentration-response curve based on animal dispersal indexes. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001705 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Dispersal assay followed the protocol reported in Crowder et al. 1996 and van Swinderen et al. 1997. Assay was also done with modifications to the protocol that includes decreasing the time for dispersal and increasing pre-treatment exposure time. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001619 | Paper_evidence | WBPaper00004721 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an EC50 of ~1.77 for isoflurane, whereas N2 has an EC50 of ~0.75 vol% as determined by a concentration-response curve based on animal dispersal indexes. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004563 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Dispersal assay followed the protocol reported in Crowder et al. 1996 and van Swinderen et al. 1997. Assay was also done with modifications to the protocol that includes decreasing the time for dispersal and increasing pre-treatment exposure time. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000641 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Dispersal index in the absence of anesthetic ~0.98 was not significantly different to N2 ~0.90. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Dispersal assay as reported in Crowder et al.1996; van Swinderen et al. 1997. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00022779 | ||||||||
WBPaper00031936 | |||||||||
WBPaper00004721 | |||||||||
WBPaper00015453 | |||||||||
WBPaper00022171 | |||||||||
Remark | sy192 (T 330 -> I) [030411 ck1] | ||||||||
Method | Substitution_allele |