WormBase Tree Display for Variation: WBVar00250241

WBVar00250241 Name: Public_name: tm1233
    Other_name: F42A6.9.1:c.498_677-43del
    HGVSg: CHROMOSOME_IV:g.3347150_3347714del
  Sequence_details: SMap: S_parent: Sequence: F42A6
    Flanking_sequences: agactgtgtaagagattcctaggccaggtg tattcgactttcagctgctcgtactctctc
    Mapping_target: F42A6
    Source_location: 7 CHROMOSOME_IV 3347149 3347715 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1233_external
      tm1233_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1233
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018330
    Transcript: F42A6.9.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F42A6.9.1:c.498_677-43del
        cDNA_position: 607-?
        CDS_position: 498-?
        Protein_position: 166-?
        Intron_number: 5-6/11
        Exon_number: 5-6/12
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
    Mapping_data: In_multi_point: 5073
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. Y. Jin: same as reported by Denken et al.(2005). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000436 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. M. Zhen: no SYD-2::GFP localization defects in GABAergic neurons; Dr. C. Bargmann: normal GFP::UNC-2 localization. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. C. Bargmann: locomotion OK. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000672 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. K. Shen to the National Bioresource Project of Japan: HSN presynaptic vesicle localization normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: TV
      WBPhenotype:0000847 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Shen: HSN presynaptic components (syd-2, syd-1, GIT-1, SAD-1) localization normal; Dr. C. Bargmann: normal GFP::UNC-2 localization. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 27776/27777-28341/28342 (565 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele