WormBase Tree Display for Variation: WBVar00250280

WBVar00250280 Name: Public_name: tm1274
    Other_name: F54A5.1.1:c.461-35_903del
    HGVSg: CHROMOSOME_I:g.990486_990963del
  Sequence_details: SMap: S_parent: Sequence: F54A5
    Flanking_sequences: gaggcgtctgaattcctaggcgaagttgct gcttcgtcttctgcgtcatcgactgctaat
    Mapping_target: F54A5
    Source_location: 7 CHROMOSOME_I 990485 990964 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1274_external
      tm1274_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1274
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018786
    Transcript: F54A5.1.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F54A5.1.1:c.461-35_903del
        cDNA_position: ?-915
        CDS_position: ?-903
        Protein_position: ?-301
        Intron_number: 2/4
        Exon_number: 3/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000306 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Barr to the National Bioresource Project of Japan: wild-type pkd-2::gfp expression. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 38575/38576-39053/39054 (478 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele