WormBase Tree Display for Variation: WBVar00251609

WBVar00251609 Name: Public_name: tm2769
    Other_name: CE05267:p.Arg165SerfsTer2
      CE05266:p.Arg143SerfsTer2
      C12D8.1c.1:c.300_475del
      CE39222:p.Arg102SerfsTer2
      C12D8.1b.1:c.489_664del
      C12D8.1a.1:c.423_598del
      C12D8.1b.2:c.489_664del
    HGVSg: CHROMOSOME_V:g.10237539_10237762del
  Sequence_details: SMap: S_parent: Sequence: C12D8
    Flanking_sequences: cattaccatcacctccactgttaagaattt gtgggattgcaatgtcaatagtggtttggg
    Mapping_target: C12D8
    Source_location: 7 CHROMOSOME_V 10237538 10237764 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: G
      Deletion
    PCR_product: tm2769_external
      tm2769_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2769
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007534
    Transcript: C12D8.1b.2 (11)
      C12D8.1a.1 (11)
      C12D8.1c.1 (11)
      C12D8.1b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000048 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: normal hatching. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000072 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: normal body shape. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 19372/19373-G-19597/19598 (225 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele