WormBase Tree Display for Variation: WBVar00251834

WBVar00251834 Name: Public_name: tm3051
    Other_name: CE24379:p.Lys21_Ter216delextTer?
      Y48A6B.11c.1:c.60_647del
      Y48A6B.11a.1:c.60_647del
      CE54304:p.Lys21_Ter216delextTer?
    HGVSg: CHROMOSOME_III:g.11063615_11064401del
  Sequence_details: SMap: S_parent: Sequence: Y48A6B
    Flanking_sequences: tttcaagtcgtggctcgcaaaaaacgacga gtcgcctttggtgaaaaaaaccacggaaac
    Mapping_target: Y48A6B
    Source_location: 7 CHROMOSOME_III 11063614 11064402 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3051_external
      tm3051_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3051
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012972
    Transcript: Y48A6B.11a.1 (11)
      Y48A6B.11c.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project from Dr E.T. Kipreos: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project from Dr E.T. Kipreos: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 73470/73471-74257/74258 (787 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele