WormBase Tree Display for Variation: WBVar00142903
expand all nodes | collapse all nodes | view schema
WBVar00142903 | Evidence | Paper_evidence | WBPaper00033138 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e5 | ||||||
Other_name (21) | ||||||||
HGVSg | CHROMOSOME_X:g.15124688G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | R07D5 | ||||
Flanking_sequences | tccacgtgaaatttattcgcgtagaaatcga | aaattggctattaccaatgggtgccgtttat | ||||||
Mapping_target | R07D5 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00033138 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (4) | ||||||||
Laboratory | CB | |||||||
OJ | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006747 | ||||||
Transcript (11) | ||||||||
Interactor | WBInteraction000518923 | |||||||
WBInteraction000518930 | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | X | 22.0113 | |||||
Mapping_data | In_2_point | 494 | ||||||
3170 | ||||||||
3636 | ||||||||
6060 | ||||||||
6165 | ||||||||
In_multi_point | 419 | |||||||
582 | ||||||||
583 | ||||||||
2417 | ||||||||
2783 | ||||||||
5472 | ||||||||
Description | Phenotype | WBPhenotype:0000002 | Paper_evidence | WBPaper00033075 | ||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPerson712 | ||||||||
Remark | unc-7 mutant animals move in a rigid and twisted manner referred as "kinkers" | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
kinker in forward movement, e5/Df similar, null phenotype. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00033075 | |||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPerson712 | ||||||||
WBPhenotype:0000017 | Paper_evidence | WBPaper00033075 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | unc-7 mutants were aldicarb resistant | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00033075 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000164 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | slightly thin, e5/Df similar, null phenotype. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000247 | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants behave like WT in a Na+ gradient assay; however, mutants are 40% responsive to Na+ in a behavior orientation assay. WT worms are 95% responsive (based on sustained distance from attractant). | Paper_evidence | WBPaper00000214 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000254 | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants are 50% responsive to Cl- in behavior orientation assay (based on sustained distance from attractant), WT are 70% responsive. | Paper_evidence | WBPaper00000214 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000353 | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants mostly move backwards, even in the presence of an attractant. Forward motion is possible, all mutants can be prodded to go forward. | Paper_evidence | WBPaper00000214 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00033075 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | UNC-7 antibody staining is absent in mutants | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | ||||||
WBPaper00033138 | ||||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson621 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00033075 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | unc-7 is required for the even distribution of GFP::SYD-2 and UNC-10 active zone markers | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001005 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001716 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001727 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002284 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002288 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002292 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002294 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002298 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002301 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002308 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002312 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002323 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002335 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002347 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002348 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002548 | Paper_evidence | WBPaper00040432 | ||||||
Curator_confirmed | WBPerson720 | |||||||
Remark | uncoordinated forward and reversal body bend propagation | Paper_evidence | WBPaper00040432 | |||||
Curator_confirmed | WBPerson720 | |||||||
WBPhenotype:0002549 | Paper_evidence | WBPaper00040432 | ||||||
Curator_confirmed | WBPerson720 | |||||||
Remark | frequent spontaneous short reversals that interrupt forward movement. Overtime the animal exhibits slow reversals | Paper_evidence | WBPaper00040432 | |||||
Curator_confirmed | WBPerson720 | |||||||
WBPhenotype:0002550 | Paper_evidence | WBPaper00040432 | ||||||
Curator_confirmed | WBPerson720 | |||||||
Remark | over half of the time, animals exhibit a 'pause'-like state - a pulled mid-body posture when head and tail actively pull the anterior and posterior bodies into opposite directions. Overtime the animal exhibits slow reversals | Paper_evidence | WBPaper00040432 | |||||
Curator_confirmed | WBPerson720 | |||||||
WBPhenotype:0004017 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | moves backward better than forward, e5/Df similar, null phenotype. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score (2) | |||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000637 | Paper_evidence | WBPaper00000214 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000641 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | active, healthy, e5/Df similar, null phenotype. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000672 | Paper_evidence | WBPaper00033075 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The synaptic vesicle markers (SNB-1::GFP and SNG-1::GFP) showed normal morphology, as well as normal number and distribution of dorsal or lateral cord puncta in unc-7 animals | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001323 | Paper_evidence | WBPaper00033075 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The synaptic vesicle markers (SNB-1::GFP and SNG-1::GFP) showed normal morphology, as well as normal number and distribution of dorsal or lateral cord puncta in unc-7 animals | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001669 | Paper_evidence | WBPaper00033075 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The synaptic vesicle markers (SNB-1::GFP and SNG-1::GFP) showed normal morphology, as well as normal number and distribution of dorsal or lateral cord puncta in unc-7 animals | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0002014 | Paper_evidence | WBPaper00027055 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | unc-7(e5) did not inhibit the electrical coupling of body wall muscle cells. | Paper_evidence | WBPaper00027055 | |||||
Curator_confirmed | WBPerson557 | |||||||
Reference (11) | ||||||||
Method | Substitution_allele |