WormBase Tree Display for Variation: WBVar00251725

WBVar00251725 Name: Public_name: tm2912
    Other_name: F02E8.3.1:c.268-38_423del
    HGVSg: CHROMOSOME_X:g.4458921_4459114del
  Sequence_details: SMap: S_parent: Sequence: F02E8
    Flanking_sequences: cattgaaaagtttgtttctaacatggtatt gaatagacagtcaagatggacccgttcaaa
    Mapping_target: F02E8
    Source_location: 7 CHROMOSOME_X 4458920 4459115 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2912_external
      tm2912_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2912
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000157
    Transcript: F02E8.3.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F02E8.3.1:c.268-38_423del
        cDNA_position: ?-423
        CDS_position: ?-423
        Protein_position: ?-141
        Intron_number: 2/3
        Exon_number: 3/4
    Interactor: WBInteraction000525183
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000030 Paper_evidence: WBPaper00032011
        Curator_confirmed: WBPerson712
        Remark: Animals grew almost normally at 15C but partially arrested at 20C. Growth of animals harboring synWT, synA53T or synA30P transgenes was severely arrested, while control animals only had milder growth rate defects. Paper_evidence: WBPaper00032011
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: 20 Paper_evidence: WBPaper00032011
              Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 15,20 Paper_evidence: WBPaper00032011
              Curator_confirmed: WBPerson712
          Genotype: tmIs429, tmIs430, tmIs431 or tmIs432 Paper_evidence: WBPaper00032011
              Curator_confirmed: WBPerson712
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. O. Blacque: could not assess Dyf phenotype due to lethality. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
              OEB
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000643 Paper_evidence: WBPaper00032011
        Curator_confirmed: WBPerson712
        Remark: Animals displayed defects in a temperature-dependent manner. Motor activities of animals harboring synWT, synA53T or synA30P transgenes were severely impaired, while animals not containing any transgene or containing a control transgene were almost normal. Paper_evidence: WBPaper00032011
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: 20 Paper_evidence: WBPaper00032011
              Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 15,20 Paper_evidence: WBPaper00032011
              Curator_confirmed: WBPerson712
          Genotype: tmIs429, tmIs430, tmIs431 or tmIs432 Paper_evidence: WBPaper00032011
              Curator_confirmed: WBPerson712
  Reference: WBPaper00032011
  Remark: 11246/11247-11440/11441 (194 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele